Kwas dimetyloguanidyno-walerianowy jest markerem tłuszczu wątrobowego i przewiduje cukrzycę ad 7

Analizy MS przeprowadzono za pomocą jonizacji przez elektrorozpylanie w trybie jonów dodatnich przy użyciu analizy pełnego skanowania od 70 do 800 m / z przy rozdzielczości 70 000 i szybkości akwizycji danych 3-Hz. Inne ustawienia MS to: gaz osłonowy 40, gaz zamiatania 2, napięcie rozpylania 3,5 kV, temperatura kapilary 350 ° C, soczewka S RF 40, temperatura grzałki 300 ° C, mikroskopy 1, cel automatycznej kontroli wzmocnienia × 106 i maksymalny jon czas 250 ms. Identyfikacja metaboliczna została potwierdzona przy użyciu autentycznych standardów referencyjnych. Surowe dane przetwarzano przy użyciu oprogramowania TraceFinder (Thermo Fisher Scientific) i Progenesis QI (Nonlinear Dynamics). Widma masowe jonów produktu (MS / MS) zebrano przy użyciu hybrydowego spektrometru kwarcowego Q Exactive Focus Hybrid Quadrupole (Thermo Fisher Scientific). Widma MS / MS zebrano na masie 202.1182 m / z. Energia kolizji wynosiła 10, 20 i 40; okno izolacyjne wynosiło 1,4 m / z; a rezolucja wynosiła 35 000. Synteza i oczyszczanie DMGV Synteza DMGV została przeprowadzona przy użyciu protokołu opisanego przez Klein i in. (42). W skrócie, ADMA (MilliporeSigma) ogrzewano w temperaturze wrzenia pod chłodnicą zwrotną w bezwodnych warunkach bezwodnikiem kwasu trifluorooctowego (MilliporeSigma) z wytworzeniem związku pośredniego ADMA-trifluoroacetamidu, a następnie przeprowadzono hydrolizę za pomocą wodorotlenku sodu, otrzymując surową mieszaninę DMGV. Oczyszczanie przeprowadzono metodą szybkiej chromatografii kolumnowej przy użyciu żelu Sephadex G-10 (MilliporeSigma). Frakcje, które utworzyły reakcję dodatnią z 2,4-dinitrofenylohydrazyną, połączono i wysuszono. Czystość oceniono za pomocą LC-MS. Test DMGV na docelowej platformie MS Depresowane ekstrakty osocza poddano HILIC w fazie normalnej stosując kolumnę Atlantis HILIC o wymiarach 150 x 2,1 mm (Waters) i następujące fazy ruchome: faza ruchoma A: 10 mM mrówczan amonu i 0,1% kwas mrówkowy (v / v); i faza ruchoma B: acetonitryl z 0,1% kwasem mrówkowym (v / v) (oba z MilliporeSigma). Próbki wstrzyknięto bezpośrednio na kolumnę HILIC, którą eluowano przy szybkości przepływu 250 l / min w początkowych warunkach 5% fazy ruchomej A i 95% fazy ruchomej B, a następnie 10,5-minutowego gradientu liniowego do 60% mobilności. faza A. Objętość nastrzyku wynosiła 10 ul. Multipleksowany system LC składał się z pompy serii 1200 (Agilent Technologies) i automatycznego podajnika próbek PAL (Leap Technologies) wyposażonego w dwa porty wtryskowe i zawór wyboru kolumny. Układ LC połączono z czterodzielnym spektrometrem masowym 4000 potrójnych ćwiartek (Applied Biosystems / Sciex) pracującym w trybie jonów dodatnich. Wielokrotne zmiany monitorowania reakcji (MRM) i chromatograficzne RT zostały obliczone dla DMGV przy użyciu infuzji autentycznych wzorców chemicznych. Analizy MS przeprowadzono z zastosowaniem jonizacji przez elektrorozpylanie (ESI) i skanów MRM w trybie jonów dodatnich. Zdolności declusteringu i energie kolizji zostały zoptymalizowane pod kątem DMGV poprzez infuzję wzorca odniesienia przed analizą próbek. Czas przebywania dla każdego przejścia wynosił 30 ms, napięcie rozpylania jonowego wynosiło 5 kV, a temperatura źródła 450 ° C. Piki metabolitów zostały zintegrowane za pomocą oprogramowania Sciex MultiQuant. Wszystkie piki metabolitów zostały ręcznie sprawdzone pod kątem najwyższej jakości w sposób zaślepiony. Ponadto, zebrane próbki ekstraktu komórkowego były przeplatane w każdym cyklu analitycznym w ustandaryzowanych odstępach co 10 iniekcji, umożliwiając monitorowanie i korygowanie czasowego dryfu w wydajności MS. Najbliższą sąsiadującą parę połączonej plazmy użyto do normalizacji próbek w sposób metabolity na metabolity. Wewnętrzne piki standardowe były monitorowane pod kątem kontroli jakości, a poszczególne próbki z obszarami pików różniącymi się od średniej grupy o więcej niż 2 SD zostały ponownie przeanalizowane. Ekspresja mRNA Agxt2 u myszy Samce myszy C57BL / 6J karmiono dietą 60% HFD w celu wywołania NAFLD rozpoczynającego się w 8 tygodniu życia. W wieku 14 tygodni myszy uśmiercono, a ich wątroby usunięto i zamrożono błyskawicznie. RNA wyekstrahowano za pomocą TRIzol-chloroformu, a następnie oczyszczono na kolumnie (RNeasy; QIAGEN). Odwrotną transkrypcję przeprowadzono stosując zestaw odwrotnej transkrypcji cDNA o dużej wydajności (Thermo Fisher Scientific). Ilościowy PCR (qPCR) próbek w dwóch powtórzeniach przeprowadzono na maszynie QuantStudio 6 Flex (Applied Biosystems) przy użyciu Power SYBR Green PCR Master Mix (Applied Biosystems). Poziomy mRNA Agxt2 znormalizowano do poziomów białka wiążącego TATA, stosując następujące startery: Agxt2 forward, ACCCGAAGGTAAGTGCAGTG; Agxt2 reverse, CCAGGTCGTTGGCTTCTGAT; Tbp do przodu, GGGTATCTGCTGGCGGTTT; Tbp reverse, TGAAATAGTGATGCTGGGCACT. Wartość DMGV osocza mierzono za pomocą LC / MS, jak opisano powyżej dla ludzkiego osocza. Statystyka Wszystkie poziomy metabolitów zostały ustandaryzowane do najbliższej wartości zebranego metabolitu osocza w kohorcie, a następnie przekształcone logarytmicznie z powodu ich nie-normalnego rozkładu
[więcej w: odkwaszanie organizmu przepisy, kalkulator kalorii na mase, ośrodki terapii uzależnień ]
[przypisy: infekcja dróg moczowych objawy, ośrodki terapii uzależnień, właściwości olejku rycynowego ]